When I was a freshman in high school, taking biology for the first time, it seemed like an endless list of facts. When we learned about specific scientists and their discoveries it was Leeuwenhoek, Mendel, Darwin--these men have been dead for a century or more. The most contemporary discovery covered in the usual high school biology text is Francis and Crick's discovery of DNA's structure in 1953. I assumed that the lack of news for the past 50 years meant that there was nothing new to report, which meant that we knew all we needed to know about biology.
Yeah, I was wrong-o.
Of course, it was in college that I learned the extent of the stuff we don't know. I mean, good god, we still don't completely understand the human body and disease, so grasping large systems like whole ecosystems or the global ecosystem--yikes--it's overwhelming.
I think that what we don't know about science is sometimes more interesting than what we do know. It's so mysterious: we may not even even know what we don't know. New discoveries answer 1 question and raise 100 more. We will never know everything about everything, and thank goodness for that. I hope scientists for millennia to come will keep finding deep, meaningful questions to investigate.
Viva science!
October 20, 2009
October 09, 2009
Nature vs. Nurture
Nature =
Nurture =
- Your genes
- Your genetic destiny
- That which you cannot change about yourself
- Fate
- Destiny
- Nothing you can do about it
- You were born this way
Nurture =
- The way you were raised
- Your experiences
- How your life experiences shape who you are and who you will become
- You can choose and have control over who you are
As with most ongoing debates, there are people who are 100% on one side or the other, and the answer is most likely right smack-dab in the middle. But don't tell anyone I said that. It's too easy.
The best way to study nature vs. nurture questions is to look at identical twins that were separated at birth. If you look at genetically identical people who had different life experience (nurture) then you can tell just how much your DNA (nature) determines who you will become.
I will never forget the first twin study I read about. These identical twin boys were adopted by different families. They both grew up to be overweight firemen with beards, and they married blonde women with similar names. Woah.
The problem is that there are also twin studies where identical twins raised in different circumstances turned out to be very different. So... where does this leave us?
The answer is that we don't have the answer just yet, but we have been unraveling a lot of the information stored in DNA just in the last decade. Someday we might be living in a GATTACA-esque time, where the moment a baby is born, her DNA can be read, and her genetic destiny can be foretold. But even then, the thing about genetic destiny is that your genes say your predispositions, things you are likely to do or things that will probably happen to you in the future. But your health choices, your life choices, and your experiences play a very big part as well.
Someone may be born a very intelligent person, but that doesn't mean he will be successful in school or life. He has a genetic predisposition to being smart, but without hard work and good choices, that genetic gift doesn't mean anything.
Maybe someday we will entirely unravel the information in our DNA and we will be able to tell everything about our futures, from the disease we are prone to, to the choices we will make. But in a way, I hope that our experiences and random behavior will always prove to be a significant part. Because knowing your future isn't really very much fun.
"Sometimes a man can meet his destiny on the path he took to avoid it."
The problem is that there are also twin studies where identical twins raised in different circumstances turned out to be very different. So... where does this leave us?
The answer is that we don't have the answer just yet, but we have been unraveling a lot of the information stored in DNA just in the last decade. Someday we might be living in a GATTACA-esque time, where the moment a baby is born, her DNA can be read, and her genetic destiny can be foretold. But even then, the thing about genetic destiny is that your genes say your predispositions, things you are likely to do or things that will probably happen to you in the future. But your health choices, your life choices, and your experiences play a very big part as well.
Someone may be born a very intelligent person, but that doesn't mean he will be successful in school or life. He has a genetic predisposition to being smart, but without hard work and good choices, that genetic gift doesn't mean anything.
Maybe someday we will entirely unravel the information in our DNA and we will be able to tell everything about our futures, from the disease we are prone to, to the choices we will make. But in a way, I hope that our experiences and random behavior will always prove to be a significant part. Because knowing your future isn't really very much fun.
"Sometimes a man can meet his destiny on the path he took to avoid it."
October 05, 2009
Chimpanzees and Humans
A good friend of mine once asked me a good question:
If humans evolved from chimpanzees, why are there still chimpanzees around today?
This causes a lot of confusion, and I completely understand why. If you think about evolution in linear terms, this doesn't make any sense. The truth is that evolution is not a goal-oriented process that is always moving forward. Evolution happens when chance mutations cause a group of organisms to change. This happens very rarely, actually. Most groups of organisms go extinct or change very little over time.
Evolution is not guaranteed. Some species have remained largely unchanged for hundreds of millions of years. Some, like us, have changed dramatically in a few million years. There are many factors that can cause a species to change, and a big one is chance mutations.
Mutation happens. They can be good, neutral, or bad. Most mutations are neutral and just cause random variation in a population. Consider eye color, for example. There is a wide range of eye colors that could all be considered mutations of the genes that cause eye color. Eye color determines very little about survival or reproductive success, so these mutations are rather neutral.
Without getting bogged down in all the details, here is how it went:
A few millions years ago there were several types of early primates. An individual in one of these groups, let's call her Jane, was born with a mutation that caused her brain to be slightly larger, so she was slightly more intelligent. Jane survived longer and had more children than some of her non-so-smart friends. Her children inherited her successful traits and grew up to have many children as well. You can see that over time, just one mutation can increase in a population if it causes those individuals to survive and have more kids than others. Remember that survival and having babies is not guaranteed in nature. So those that don't have "good" traits will not survive or will not reproduce and pass those traits on.
After many more generations of the smartest primates having many children, you now have a whole population of smarter primates. The group of primates on the other side of the hill didn't experience this smart mutation, so they stayed the same during all of this.
This is essentially how we have ended up with humans evolving while other primate species stay the same. We say that they are our ancestors, but they are really distant cousins. We share a ancestor with chimpanzees, but we as a group experienced a few key mutations that made us who we are, while the group of chimpanzees a few miles away did not get those mutations. I wonder if they're jealous.
If humans evolved from chimpanzees, why are there still chimpanzees around today?
This causes a lot of confusion, and I completely understand why. If you think about evolution in linear terms, this doesn't make any sense. The truth is that evolution is not a goal-oriented process that is always moving forward. Evolution happens when chance mutations cause a group of organisms to change. This happens very rarely, actually. Most groups of organisms go extinct or change very little over time.
Evolution is not guaranteed. Some species have remained largely unchanged for hundreds of millions of years. Some, like us, have changed dramatically in a few million years. There are many factors that can cause a species to change, and a big one is chance mutations.
Mutation happens. They can be good, neutral, or bad. Most mutations are neutral and just cause random variation in a population. Consider eye color, for example. There is a wide range of eye colors that could all be considered mutations of the genes that cause eye color. Eye color determines very little about survival or reproductive success, so these mutations are rather neutral.
Without getting bogged down in all the details, here is how it went:
A few millions years ago there were several types of early primates. An individual in one of these groups, let's call her Jane, was born with a mutation that caused her brain to be slightly larger, so she was slightly more intelligent. Jane survived longer and had more children than some of her non-so-smart friends. Her children inherited her successful traits and grew up to have many children as well. You can see that over time, just one mutation can increase in a population if it causes those individuals to survive and have more kids than others. Remember that survival and having babies is not guaranteed in nature. So those that don't have "good" traits will not survive or will not reproduce and pass those traits on.
After many more generations of the smartest primates having many children, you now have a whole population of smarter primates. The group of primates on the other side of the hill didn't experience this smart mutation, so they stayed the same during all of this.
This is essentially how we have ended up with humans evolving while other primate species stay the same. We say that they are our ancestors, but they are really distant cousins. We share a ancestor with chimpanzees, but we as a group experienced a few key mutations that made us who we are, while the group of chimpanzees a few miles away did not get those mutations. I wonder if they're jealous.
Ask a Question
Do you have a random biology question you've always wondered about?
Please ask!
Email beatrice.biologist@gmail.com with your question.
Please ask!
Email beatrice.biologist@gmail.com with your question.
October 02, 2009
Baldness Doesn't Come from Your Dad
I once saw a commercial for a rogaine-like product that helps bald men recultivate their bald patches. The man in the commercial walks down a hallway practically wallpapered with family photos as he describes the annoyances of baldness. He gets to a picture of his father and sassily says, "Thanks, dad."
I completely understand why a man would assume he gets the baldness gene from his father, but it's just not true. Men, if you go bald, the only person you can blame is your mother (but please don't blame her anyway).
(For the record, I don't like the idea of the man in the rogaine commercial saying, "Thanks, mom," and rolling his eyes. It might be correct, but it's still not cool.)

The gene for baldness or none-baldness is on the X chromosome. You have probably heard of the X and Y chromosomes, also called sex chromosomes because, yes, they determine the sex of the person.
XX = female
XY = male
You get half your chromosomes from your mother's egg, and the other half from your father's sperm (if nothing goes wrong, that is). Since females have two X chromosomes, all eggs get an X chromosome--because females don't have anything else to give. Males have an X and a Y, so half the sperm a man makes have an X, and the other half have a Y.
Because of this, it is the sperm that determines a baby's sex:
1. If a sperm with an X chromosome gets there first, it's a girl.
X from mom + X from dad = girl
2. If a sperm with a Y chromosome gets to the egg first, it will be a boy.
X from mom + Y from dad = boy
Now, you might already be starting to see why a man can't give his son the baldness gene. The baldness gene, again, is on the X chromosome. Dad's don't give their sons an X chromosome, they give them the Y--that's what makes the baby a boy. So father's can't give their sons any traits that are on the X chromosome.
Boys inherit the baldness gene from the X chromosome that they get from their mothers. She may have gotten that X chromosome from her father, though. So an angry bald man could blame his bald grandfather if he really wanted to (but it still might have come from his grandmother).
The baldness gene being on the X chromosome also explains why baldness is more common in men than in women.
Baldness is recessive. None-baldness is dominant. If you have one gene for "bald" and one gene for "not-bald," you will not be bald, because "not-bald" is dominant. The only way to go bald is if you have 2 "bald" genes, or 1 "bald" gene and... a Y chromosome that doesn't have this gene at all, so nothing to mask the "bald" gene.
Women have 2 X chromosomes, so they have 2 chances to get the non-baldness gene. For a woman to go bald, both her X chromosomes would have to have the baldness gene on it. The baldness gene isn't that common, so the odds of getting two X chromosomes with the baldness gene are pretty small.
Men, however, only have 1 X chromosome, so if that 1 X chromosome has the baldness gene, they don't have another X chromosome that can save them. That's all they get.
Now, if you're a man and you're wondering if you are someday going to go bald, look at your mom's family. If she has a brother who is going bald, you have a 50% chance of going bald too. But don't worry, you can use rogaine. What you can't do it use rogaine thinking that you inherited baldness from your father. Not cool.
October 01, 2009
Your Friend, DNA
Deoxyribonucleic acid.
Dee-ox-ee-rye-bo-new-clay-ick-acid.
Yeah! That's what DNA stands for.

DNA has instructions to make all the proteins that make you who you are. How do proteins determine who you are? Well, the kinds of proteins your cells make, how many of them, and when, determines your height, hair color, eye color, skin color, personality, talents, and well, everything else about you. Now, some things can change slightly based on your life experiences--such as likes and dislikes--but the basics of who you are come from DNA's set of instructions.
DNA is shaped like a twisted ladder (also known as a double helix). Considering how much information it has, its structure is quite simple. The sides of the ladder are made of a sugar (called deoxyribose) and something called a phosphate group (4 phosphorous atoms around an oxygen atom) repeated over and over again. Phosphate, sugar, phosphate, sugar, phosphate, sugar... The rungs of the ladder are made up of the bases you've probably heard of: adenine, thymine, cytosine, and guanine. A, T, C, and G for short.

The order of the bases determines what proteins are made. So people say that DNA is a language with just 4 letters. Now, if we only had these four letters in the English language, conversations would be pretty boring.
Not many words can be expressed in English with 4 letters, but LOADS of information can be carried in DNA. A "word" in DNA's language is a gene, a DNA sequence that has instructions for a certain protein. Genes are thousands of letters long, which is how they can have so much information with only 4 letters. Here is a really short gene if we read one side of the DNA:
ACTGCCCGGTTTCCCTGAACCTGTATACGATCGACGGCGCCATGATATATCGGCGCATATCGCGCGCTAATGCGATCATCGATGCATCGATCGAGCGCCGATATATCGCGAGACGACGTAGCAGAGCATCGCGATCGCGATGCAGCGCGATAGCGCTAGCGCGATTTTTTAGAGAGAACACACGCGCGCCCCCCGCCTCCCTCCCCACACCACCGGGGATATCGCGATACGTTTCGCCAG
This gene isn't real, but let's pretend it's the genetic sequence for melanin, the protein that causes brown pigment in hair and skin. This sequence tells the cell how to make the protein. And when the gene is "on," lots of the protein is produced.
The last thing to know about DNA is that the letters don't just pair up randomly. C pairs with G, and A pairs with T. They go on a lot of double dates, of course, but C always sits next to G, and A always sits with T.

It, uh, doesn't really work in any other combination. If this is attempted, it gets a little awkward.
Lack of Natural Selection
I like to think about how many times and how many ways I would have died already if I happened to be born 25,000 years ago instead of 25 years ago. I say I like to think about it because none of them have happened, so I can be glad. And I think you should too.
Here are the 5 most plausible deaths of my hypothetical prehistoric existence:

1. Dead at 1 day old
I was an enormous, 10-pound baby. I was so huge, I couldn't maintain a stable body temperature for a few days (so I was a big fan of heat lamps). I think it is a fair bet that I wouldn't have survived the first year of my life if I hadn't been born in this century.We often forget that not long ago, it was not surprising for babies to die in the first few years, or for mothers to die during childbirth. I'm not talking about thousands of years ago, either. If you go back just one century or more, infant mortality rates were significantly higher. So even if I hadn't been a troublesome baby, statistically, I wouldn't have had a good chance of surviving the first few years.
2. Eaten by a bear
I am clumsy, and what little coordination I have doesn't stand up terribly well to high-pressure situations. I can all but guarantee you that if I was being chased by a hungry, large-toothed animal, I would trip over even the most unobtrusive rock or twig and be greedily consumed.

3. Fallen off a cliff
I was born with less than aweswome vision. I had to wear glasses (and get teased for it) when I was in kindergarten. If I had been born before glasses were invented, I would have been stumbling around with my arms outstretched looking for a landmark or friend.It is perfectly likely that one of those days, I would have gotten too adventurous and gone half-blindly exploring near a cliff, quickly finding myself at the bottom of it.
4. Infection
As clumsy as I am, I'm not as accident-prone as I should be, but I have had a few pretty bad, self-imposed injuries: falling off my bike, mangling my face; smashing my thumb in a car door, breaking it; slicing into my finger while cutting tomatoes (I do this a lot). Had I done any of these things before hand soap and hospitals were around, I would have lost fingers to infection, if I didn't entirely succumb to it and die.
5. Competition
I'm not a competitive person. Sure, I have a vague interest in being good at stuff, but I'm not a head-to-head, "you're going down" kind of person with any kind of regularity. So if push came to shove, and food or water resources were scarce, I'd probably be more likely to share than hoard. This behavior would benefit me if everyone else did the same, but in a life-or-death, every-man-for-himself situation, I wouldn't be the one to let others die so I could live. So that would be the end of prehistoric me. Oh, well.
Obviously, I am very glad that I was born in the 80s instead of 8,000 B.C. The fact that I have survived this long, despite my imperfections, means I can someday have my own clumsy, blind, compassionate children who can continue the lineage of these traits. Luckily, they will be born in a time where those traits won't mean their demise.
That is what most call progress and what I call human beings being exempt from Natural Selection. Thank goodness.
Subscribe to:
Posts (Atom)




